@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTA + ;;>@BCEFGHJKLMNOPQRSTUVWXYZ[\]^_`abcdefgh @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) gTcatAGcgTcatAGcgTcatAGcgTcatAGcgTcatAGcg + ;;>@BCEFGHJKLMNOPQRSTUVWXYZ[\]^_`abcdefgh @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) tcagtcagtcagtcagtcagtcagtcagtcagtcagtcagt + ;;>@BCEFGHJKLMNOPQRSTUVWXYZ[\]^_`abcdefgh @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) gatcrywsmkhbvdnGATCRYWSMKHBVDN + h^TJh^TJh^TJh^TJh^TJh^TJh^TJh^